Abstract: In order to develop the medicinal value of algae, the effects of phycocyanin (PC) on carbon tetrachloride (CCl4)-induced hepatic fibrosis in rats were investigated. The rats were randomly divided into three groups: control group, liver fibrosis group and CCl4+PC intervention group. In the liver injury model induced by intraperitoneal injection of CCl4, the expression of collagen type I (Co-I) and alpha-smooth muscle actin (α-SMA), which are markers of liver fibrosis, were detected by RT-PCR, and the expression of 16S rRNA (16S rRNA) was detected by high-throughput sequencing. The composition and structure of rat intestinal microorganisms were examined by 16S rRNA sequencing, and the RT-PCR results showed that PC intervention significantly reduced the expression of α-SMA and Co-I, which are markers of fibrosis, in the livers of rats induced by CCl4. CCl4 induced disruption of the intestinal flora of rats, and significantly reduced the expression of the probiotic Bacteroides, which has anti-inflammatory activity, CCl4-induced disruption of the intestinal flora in rats significantly reduced the abundance of anti-inflammatory probiotics Bacteroides, Blautia, and Parabacteroides, while PC intervention significantly increased the abundance of anti-inflammatory probiotic Blautia.
The results showed that PC was able to improve CCl4-induced intestinal flora disturbance, and this improvement may help to alleviate CCl4-induced liver fibrosis.
Hepatic fibrosis (hepatic fibrosis) is the response of liver cells to repair repeated or successive injuries when the liver is exposed to stimuli. Hepatic fibrosis occurs when prolonged injury or inflammation causes excessive scar tissue to build up in the liver. Liver fibrosis is an essential stage in the progression of all chronic liver diseases to cirrhosis, and advanced liver fibrosis can lead to liver failure and even liver cancer [1]. Currently, liver disease has a high morbidity and mortality rate worldwide, which is associated with increasing economic and social impact. There is a lack of effective therapies for the treatment of liver fibrosis.
Since the occurrence of liver fibrosis involves multiple factors and pathways, the prevention and treatment of liver fibrosis is difficult. Currently, there are no specific drugs for the treatment of liver fibrosis, and only two traditional Chinese medicines (TCM), turtle shell soft liver tablets and Fuzheng Huayu tablets, have been approved for the treatment of liver fibrosis [2]. Recently, many studies have shown that liver diseases are related to gut microorganisms. The intestinal tract and the liver exchange substances through the bile ducts, portal vein and body circulation.
Metabolites of hosts and microorganisms in the gut can translocate to the liver via the portal vein and affect bile acid synthesis, glucose and lipid metabolism in the liver. For example, the microbial metabolite of aromatic amino acids, phenylacetic acid, plays a key role in the pathogenesis of non-alcoholic fatty liver disease (NAFLD)[3] . Pathogen associated molecular patterns (PAMPs), such as lipopolysaccharide (LPS) produced by intestinal microorganisms, can also cross the intestinal barrier and enter the liver via the circulatory system, activating hepatic macrophages and generating pro-inflammatory factors, resulting in liver damage and fibrosis[4-5] . This can lead to liver damage and fibrosis[4-5] . Therefore, the homeostasis of intestinal microorganisms can affect the health of the liver, and a variety of intestinal microbial dysbiosis have been observed in patients with liver diseases [6].
Phycocyanin (PC) is a natural pigment protein usually found in cyanobacteria and red algae, and most of the PC prepared on a large scale is from Spirulina. Recent studies have proved that PC has the effects of anti-pulmonary fibrosis, liver protection and intestinal flora regulation [7-10], and it is also easily available, safe and non-toxic, which suggests that PC may be a potential substance for the improvement of hepatic fibrosis. In this paper, we investigated the effects of PC on CCl4-induced hepatic fibrosis and on intestinal flora, and explained the mechanism of intestinal flora in the antifibrotic process of PC.
1 Material
1.1 Instruments
7500 Real-Time Quantitative PCR (Applied Biosystems, 7500 Fast System), Basic Electrophoresis (Bio-RAD, Power-Pac Basic), Gel Imaging System (Bio-RAD, Chemi- Doc XRS+), Orthostatic Microscope (Zeiss, Axio Scope. A1), Inclusion Machine (Leica, ARCADIA), Paraffin Slicer (Leica, RM2235). Scope.A1), an embedding machine (Leica, ARCADIA), and a paraffin slicer (Leica, RM2235).
1.2 Drugs and reagents
The PC (Product No. C-190430, Amax/ A280=3.0) used in this experiment was purchased from Fuqing New Daize Spirulina Co. RNAiso Plus (Total RNA Extraction Reagent), PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time), TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus) were purchased from Takara Company; HE Staining Kit and Masson Staining Kit were purchased from Beijing Soleilbao Technology Co.
1.3 Laboratory animals
21 SPF grade Wistar male rats, weighing 130~160 g, purchased from Jinan Pangyue Laboratory Animal Breeding Co., Ltd, License No. SCXK(LU) 2019 0003, were housed in Shandong International Biotechnology Park.
2 Methodology
2.1 Grouping of experimental animals and interventions
The rats were housed at a temperature of (23±2) ℃, relative humidity of (45±10)%, and a photoperiod of 12 h of light/12 h of darkness, and were fed and watered ad libitum. After one week of acclimatization, 21 rats were randomly divided into 3 groups of 7 rats each, labeled by body weight. The groups were control (NC), fibroblasted liver (FIB), and CCl4+PC intervention (FIB_PC). 100 mg/kg of PC was gavaged daily in the CCl4+PC intervention group, and the control group was gavaged with the same volume of distilled water for 4 weeks. Hepatic fibrosis was modeled by intraperitoneal injection of CCl4 as follows: CCl4 olive oil solution at 12.5% by volume was injected intraperitoneally at 0.01 mL/g body weight twice a week for 4 weeks [11].
2.2 Sample Collection
Feces are collected on the last day of the intervention. The rats will defecate when they are gently picked up (if no feces is excreted, a sterile cotton swab can be used to gently stimulate the anus of the rats to defecate). The freshly excreted feces samples will be collected in sterile cryopreservation tubes, and then immediately put into liquid nitrogen for freezing, and then placed in a -80 ℃ refrigerator for preservation.
2.3 HE and Masson staining of rat liver tissue
After the rats were anesthetized by intraperitoneal injection of 10% chloral hydrate (0.3 mL/100 g rats), the largest lobe of the liver was fixed in 4% paraformaldehyde fixative, and then fixed in a refrigerator at 4 ℃ for 24 h. The liver was stained with HE staining (hematoxylin and eosin stain) and Masson staining (Masson's trichrome stain) in the same way as described in the instructions to determine the stage of inflammatory cells and fibrosis in the liver tissue. After fixation for 24 h at 4 ℃ in a refrigerator, HE staining (hematoxylin and eosin stain) and Masson's trichrome stain were performed according to the methods described to determine the stage of hepatic fibrosis by identifying the degree of inflammatory cells and fibrosis in the liver tissue. The remaining liver tissues were stored in a refrigerator at -80 ℃ for subsequent detection of related gene expression.
2.4 RT-PCR to detect the expression of fibrosis markers in rat liver tissues
Total RNA was extracted from the liver tissue of 3 rats in each group using RNAiso Plus reagent. The amplification primers for collagen type I (Co-I) and alpha-smooth muscle actin (α-SMA) were synthesized by Beijing Ruibo Xingke Biotechnology Co. The sequences were as follows.
α-SMA_F GCCATCAGGAACCTCGAGAA; α-SMA_R AGCTGTCCTTTTGGCCCATT; Co-I_F GGAGAGA GCATGACCGATGG; Co-I _R GGGACTTCTTGAG GTTGCCA; β-actin_F CGTAAAGACCTCTATGCC AACA; β-actin_R GGAGGAGCAATGATCTTGA TCT. 2 technical parallels were set for each sample. The PCR reaction conditions were as follows: pre-denaturation at 95 ℃ for 30 s, cycling, 40 cycles, denaturation at 95 ℃ for 5 s, annealing and extension at 60 ℃ for 30 s. The relative expression of the target genes was calculated by the double-delta Ct method (2-ΔΔCt) with β-actin as the internal reference.
2.5 High-throughput sequencing of intestinal flora
Genomic DNA was extracted from rat fecal samples using the Fecal DNA Extraction Kit, which was based on the V3-V4 variable region primers of the bacterial 16S ribosomal RNA gene (338F 5'-ACTCCTACGGGGAG GCAGCAG-3' and 806R 5'-GGACTACHVGGGGTWTC TAAT-3'), and amplified by PCR (ABI GeneAmp® 9700 PCR instrument). The extracted DNA samples were amplified by PCR (ABI GeneAmp® 9700 PCR instrument). 2% agarose electrophoresis was used to detect the amplified samples, and the PCR products were recovered by cutting the gel using the AxyPrepDNA Gel Recovery Kit (AXYGEN), and the PCR products were recovered by using the TruSeqTM DNA Sample Prep Kit (Illumina). The TruSeqTM DNA Sample Prep Kit (Illumina) was used to construct MiSeq libraries, and sequencing was performed using the Illumina MiSeq sequencing platform according to the sequencing procedure.
2.6 Statistical methods
The data were statistically analyzed by IBM SPSS Statistics 22 software, and the final results were presented as mean ± standard deviation (x ± s), with one-way ANOVA to test the significance of different groups, and Wilcoxon's rank-sum test to analyze the significance of different groups of bacterial colonies. p<0.05 indicated that there was a significant difference between different groups.
3 Results
3.1 Effect of PC on markers of CCl4-induced liver fibrosis in rats
The relative expression of α-SMA and Co-I mRNA in the tissues of each group is shown in Figure 1.The expression of α-SMA and Co-I in the liver of the FIB group was significantly higher than that of the NC group (P<0.05), whereas the expression of α-SMA and Co-I in the liver of the FIB_PC group was significantly lower compared with that of the FIB group (P<0.05).
3.2 Pathologic analysis of rat liver
HE staining and Masson staining were used to evaluate the degree of liver injury in rats. The results of HE staining showed that the liver structure was normal in the NC group, while a large number of eosinophils and a large number of vacuolar degenerated hepatocytes were found in the FIB group. In the FIB_PC group, the number of eosinophils and vacuolated hepatocytes were reduced compared with that in the FIB group. Masson staining showed that in the NC group, there were only a few collagen fibers stained blue in the confluent area, while in the FIB group, there were a large number of collagen fibers around the confluent area, and the collagen fibers were connected together to form fibrous septa, indicating that the rats had symptoms of liver fibrosis at this time. In the FIB_PC group, although a certain amount of fibers also existed in the confluent area, no fibrous septum was formed, and the degree of fibrosis was lower than that in the FIB group (Figure 2). Combined with the results in Figure 1, it showed that CCl4 induced liver fibrosis for 4 weeks, and PC intervention could alleviate the liver fibrosis caused by CCl4.
3.3 Basic quality control analysis of intestinal microorganisms
A total of 1,043,032 valid sequences were generated from 21 fecal samples, and the number of valid bases was 505,342,145 bp, with the average length of valid sequences being 423 bp. The Shannon index of the dilution curves of the samples reached a plateau (Fig. 3a), and the coverage index reached a level of 1.5 bp.
The data volume of this sequencing was more than 95% (Fig. 3b), and the reads number was more than 35 000, which indicated that the data volume of this sequencing was sufficient to reflect the real situation of the composition of the intestinal flora of rats.
3.4 Impact on OTUs
The reads obtained were clustered with 97% similarity, and a total of 960 operational taxonomic units (OTUs) were obtained (Fig. 3c), with 760 in the NC group, 830 in the FIB group, and 847 in the FIB_PC group, and 639 OTUs common to all these groups, 38 unique to the NC group, 32 unique to the FIB group, and 52 unique to the FIB_PC group. There are 639 OTUs common to these groups, 38 unique to the NC group, 32 unique to the FIB group, and 52 unique to the FIB_PC group.
3.5 Cluster analysis of OTUs
The results of OTUs cluster analysis and principal co-ordinates analysis (PCoA) are shown in Fig. 3d. The 95% confidence intervals were used to add grouping ellipses to each group. The results showed that the distribution of NC, FIB and FIB_PC groups was relatively concentrated. There was no intersection of NC group with FIB and FIB_PC groups, indicating that both PC and CCl4 could change the intestinal flora. The results showed that the distribution of the NC group, FIB group and FIB_PC group in the corresponding points of the graph was relatively concentrated, and there was no intersection of the grouping ellipses of the NC group with those of the FIB group and the FIB_PC group, which indicated that both PC and CCl4 could change the intestinal flora. Compared with the FIB group, the classification ellipse of the PC_FIB group is farther away from that of the NC group, which may be due to the double intervention of CCl4 and PC in the PC_FIB group and the fact that PC is a gavage intervention, which is in direct contact with intestinal microorganisms in the digestive tract, and therefore has a greater influence on intestinal microorganisms.
At the level of phylum, the phylum with relative abundance less than 0.005 was designated as the other group, and it was found that the main phylum in the rat intestine were Firmicutes and Bacteroidetes (Figure 4). In the FIB group, CCl4 induced an increase in the relative abundance of Firmicutes and a decrease in the relative abundance of Bacteroidetes compared with the NC group. The ratio of Firmicutes to Bacteroidetes was decreased in the FIB_PC group compared to the FIB group.
At the family level, CCl4 induced a decrease in the abundance of Bacte- roidaceae, Rikenellaceae and Tannerellaceae, and an increase in the relative abundance of bacteria from these families after the addition of PC. In addition, the relative abundance of Streptococcus alimentarius (Peptostreptoco- ccaceae) and Bifidobacteriaceae (Bifidobacteriaceae) was significantly increased in the FIB_PC group compared with the NC group (Fig. 5).
At the genus level, the relative abundance of Bacteroides, Parabacteroides and Blautia in the FIB group was significantly lower than that in the NC group (P<0.05). The relative abundance of Allobaculum and Bifidobacterium in the FIB_PC group was significantly higher than that in the FIB group (Figure 6).
4 Conclusion and discussion
Because CCl4 intraperitoneal injection induces liver fibrosis similar to the liver injury caused by real chemicals, this liver fibrosis model is widely used in laboratories. In this experiment, α-SMA and Co-I, markers of hepatic fibrosis, were significantly increased in the liver tissue of rats induced by CCl4, and the pathologic examination revealed fibrotic lesions in the liver, indicating that the modeling was successful.
CCl4 can cause liver damage in several ways: CCl4 breaks carbon bonds in biological tissues and forms reactive trichloromethane (CCl3-) and trichloromethane peroxy (CCl3OO-) radicals, which attack liver cells and lead to lipid peroxidation on the cell membranes, causing sustained damage to hepatocytes [12]. These free radicals attack liver cells, leading to lipid peroxidation in the cell membrane, which in turn causes sustained damage to hepatocytes [12]. Previous studies have shown that PC can reduce CCl4-induced liver injury through antioxidant effects.Vadiraja et al[13] showed that PC was able to scavenge CCl4-produced free radicals in rat liver, thereby reducing lipid peroxidation and liver injury.
Ou et al [7] demonstrated that PC could reduce CCl4-induced liver injury by scavenging reactive oxygen species (ROS) and enhancing the activities of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px). CCl4-induced liver injury. In addition, phycocyanobilin (PCB), a chromophore on PC, significantly increased SOD levels in serum and liver of CCl4 mice and reduced liver injury [12]. In the present study, PC intervention reduced the CCl4-induced increase of α-SMA and Co-I in rat liver tissues, and improved the pathological state of rat liver tissues, suggesting that PC has the effect of ameliorating liver fibrosis.
In addition to the induction of lipid peroxidation, CCl4-induced hepatic fibrosis may also be related to the intestinal flora. D'Argenio et al[14] induced hepatic fibrosis in rats with CCl4, and found that the intestinal flora was dysbiotic in the fibrotic rats. The dysbiosis of intestinal bacteria was also found in cirrhotic patients. Qin et al[15] revealed the difference between the bacterial flora of cirrhotic patients and that of healthy patients by quantitative macrogenomics, and found that the abundance of Bacteroidetes was decreased and the abundance of Firmicutes was increased in the intestinal tracts of cirrhotic patients compared with that of healthy patients. Firmicutes/Bacteroidetes (F/B) can reflect the dysbiosis of intestinal microorganisms. In this study, Firmicutes and Bacteroidetes were the main phyla in rat feces, which accounted for more than 90% of the total microorganisms in rats and covered most of the intestinal bacteria in terms of quantity. CCl4 induced an increase in the abundance of Firmicutes and a decrease in the abundance of Bacteroidetes, suggesting that CCl4 induced intestinal dysbiosis in rats, whereas PC suppressed the decrease in the abundance of Bacteroi- detes and the increase in the abundance of Firmicutes induced by CCl4.
In this study, CCl4 intervention reduced the abundance of Bacteroides, Parabac- teroides, and Blautia, all of which produce short-chain fatty acids [16-20]. Short-chain fatty acids in the intestine have anti-inflammatory effects, and a decrease in short-chain fatty acids increases the inflammatory response of the body [21]. Previous studies have observed a decrease in the abundance of Parabacteroides in autoimmune hepatitis [22], and a significant decrease in B. blautiae in patients with NAFLD and fibrosis [23].
Yan et al[24] observed that the abundance of Bacteroides in the intestinal tract of rats decreased after CCl4 treatment. D'argenio et al [14] found that the intestinal flora of rats with CCl4-induced liver fibrosis was disturbed and the level of pro-inflammatory cytokines was increased. This suggests that CCl4 may reduce the abundance of short-chain fatty acid-producing bacteria, increase inflammation, and promote the development of hepatic fibrosis. PC intervention increased the abundance of the probiotic Blautia in the gut. Blautia can regulate the immune response, thus exerting anti-inflammatory activity and improving the prognosis of patients with cirrhosis [25]. Therefore, we hypothesize that PC can regulate the immune response by modulating the intestinal flora, thereby reducing the level of inflammation in the liver and alleviating liver fibrosis.
PC has a good effect on CCl4-induced liver fibrosis. In this paper, we compared the effects of PC intervention on the composition and structure of intestinal microorganisms in rats with CCl4-induced hepatic fibrosis for the first time. The results showed that PC could increase the abundance of probiotics with anti-inflammatory activity and decrease the expression level of liver fibrosis markers in rats, which had the potential to alleviate CCl4-induced liver fibrosis. However, the metabolism of PC in the digestive tract and its interaction with microorganisms in the body and the gut are complicated. Whether PC affects hepatic fibrosis through the microorganisms in the gut, or whether PC further affects the intestinal flora by reducing hepatic fibrosis needs to be verified by fecal transplantation and other experiments.
References.
[1] SCHWABE R, BATALLER R. Liver fibrosis. fore- word[J]. Semin Liver Dis, 2015, 35(2): 95-96.
[2] ZHAO Shuangshuang, SHAO Rongguang, HE Hong- wei. Potential targets for anti-liver fibrosis[J]. Acta Pharmaceutica Sinica, 2014, 49(10): 1365-1371.
[3] CAUSSY C, LOOMBA R. Gut microbiome, microbial metabolites and the development of NAFLD[J]. Nat Rev Gastroenterol Hepatol, 2018, 15(12): 719-720.
[4] REN Yilin. The effects of gut microbiota on the devel- opment of liver fibrosis and the Intervention of An- trodia camphorata[D]. wuxi: jiangnan university, 2018.
[5] WOODHOUSE C A, PATEL V C, SINGANAYAGAM A, et al. Review article: the gut microbiome as a therapeutic target in the pathogenesis and treatment of chronic liver disease[J]. Aliment Pharmacol Ther, 2018, 47(2): 192- 202.
[6] TRIPATHI A, DEBELIUS J, BRENNER D A, et al. The gut-liver axis and the intersection with the microbio- me[J]. Nat Rev Gastroenterol Hepatol, 2018, 15(7): 397-411.
[7] OU Y, ZHENG S, LIN L, et al. Protective effect of C-phycocyanin against carbon tetrachloride-induced hepatocyte damage in vitro and in vivo[J]. Chem Biol Interact, 2010, 185(2): 94-100.
[8] XIE Y, LI W, ZHU L, et al. Effects of phycocyanin in modulating the intestinal microbiota of mice[J]. Micro- biology Open, 2019: e825.
[9] LI C, YU Y, LI W, et al. Phycocyanin attenuates pul- monary fibrosis via the TLR2-MyD88-NF-kappaB sig- naling pathway[J]. Sci Rep, 2017, 7(1): 5843-5846.
[10] LIU Qi, LI Wenjun, TANG Zhihong, et al. Research advances in the preventative and therapeutic effects of phycocyanin on oxidative stress-related diseases[J]. Marine Sciences, 2017, 41(10): 132-138.
[11] ZHAO W, YANG A, CHEN W, et al. Inhibition of lysyl oxidase-like 1 (LOXL1) expression arrests liver fibro- sis progression in cirrhosis by reducing elastin crosslin- king[J]. Biochim Biophys Acta Mol Basis Dis, 2018, 1864(4 Pt A): 1129-1137.
[12] LIU J, ZHANG Q Y, YU L M, et al. Phycocyanobilin accelerates liver regeneration and reduces mortality rate in carbon tetrachloride-induced liver injury mice[J]. World J Gastroenterol, 2015, 21(18): 5465-5472.
[13] VADIRAJA B B, GAIKWAD N W, MAADYASTHA K M. Hepatoprotective effect of C-phycocyanin: protection for carbon tetrachloride and R-(+)-pulegone- mediated hepatotoxicty in rats[J]. Biochem Biophys Res Commun, 1998, 249(2): 428-431.
[14] D'ARGENIO G, CARIELLO R, TUCCILLO C, et al. Symbiotic formulation in experimentally induced liver fibrosis in rats: intestinal microbiota as a key point to treat liver damage?[J]. Liver Int, 2013, 33(5): 687-697.
[15] QIN N, YANG F, LI A, et al. Alterations of the human gut microbiome in liver cirrhosis[J]. Nature, 2014, 513(7516): 59-64.
[16] XU J, CHEN H B, LI S L. Understanding the molecular mechanisms of the interplay between herbal medicines and gut microbiota[J]. Med Res Rev, 2017, 37(5): 1140-1185.
[17] CHOTIRMALL S H, GELLATLY S L, BUDDEN K F, et al. Microbiomes in respiratory health and disease: an Asia-Pacific perspective[J]. Respirology, 2017, 22(2): 240-250.
[18] SHUKLA S D, BUDDEN K F, NEAL R, et al. Micro- biome effects on immunity, health and disease in the lung[J]. Clin Transl Immunology, 2017, 6(3): e133.
[19] CRYAN J F, O'RIORDAN K J, COWAN C S M, et al. The microbiota-gut-brain axis[J]. Physiol Rev, 2019, 99(4): 1877-2013.
[20] QIN L, WANG Z L, FENG Y, et al. Analysis of struc- tural features of gut microbiota in two-kidney-one-clip hypertensive rats based on high-throughput sequencing technology[J]. Zhonghua Xin Xue Guan Bing Za Zhi, 2018, 46(9): 706-712.
[21] VAN DER BEEK C M, DEJONG C H C, TROOST F J, et al. Role of short-chain fatty acids in colonic inflam- mation, carcinogenesis, and mucosal protection and healing[J]. Nutr Rev, 2017, 75(4): 286-305.
[22] WEI Y, LI Y, YAN L, et al. Alterations of gut microbio- me in autoimmune hepatitis[J]. Gut, 2020, 69(3): 569- 577.
[23] BRANDL K, SCHNABL B. Intestinal microbiota and nonalcoholic steatohepatitis[J]. Curr Opin Gastroen- terol, 2017, 33(3): 128-133.
[24] YAN Z, YANG F, HONG Z, et al. Blueberry attenuates liver fibrosis, protects intestinal epithelial barrier, and maintains gut microbiota homeostasis[J]. Can J Gas- troenterol Hepatol, 2019: 5236149.
[25] JENQ R R, TAUR Y, DEVLIN S M, et al. Intestinal blautia is associated with reduced death from graft- versus-host disease[J]. Biology of Blood & Marrow Transplantation, 2015, 21(8): 1373-1383.
.jpg)
.jpg)
.jpg)
没有评论:
发表评论